View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7656_low_7 (Length: 282)
Name: NF7656_low_7
Description: NF7656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7656_low_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 24 - 282
Target Start/End: Original strand, 51938015 - 51938282
Alignment:
| Q |
24 |
ggcgttcctcttcagaaatagaggcaaagggagattgtgttgttgttgatgatctgataggagtgttaggagttgactt---------cttcttctgtag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51938015 |
ggcgttcctcttcagaaatagaggcaaagggagattgtgttgttgttgatgatctgataggagtgttaggagttgacttgttgttcttcttcttctgtag |
51938114 |
T |
 |
| Q |
115 |
agaatgaagttcgtgaattgtttgggctttcaccgatgggctgctgtcgtcgtgacatatctccgaagaatccataactttcttgtgggtttggatcatg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51938115 |
agaatgaagttcgtgaattgtttgggctttcaccgatgggctgctgtcgtcgtgacatatctctgaagaatccataactttcttgtgggtttggatcatg |
51938214 |
T |
 |
| Q |
215 |
ggtagcccacgacgcccaacaacgttgtcaatagttgttccatttctgaaatctgatccattcttctc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51938215 |
ggtagcccacgacgcccaacaacgttgtcaatagttgttccatttctgaaatctgatccattcttctc |
51938282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University