View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7658_high_5 (Length: 239)
Name: NF7658_high_5
Description: NF7658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7658_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 27755857 - 27755657
Alignment:
| Q |
17 |
aatattaatggtaaacctaaggtcaatgcttcgattttcttgaagagttcagatacggttataacaagcttaggtttggagtcatggatttgcctagaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27755857 |
aatattaatggtaaacctaaggtcaatgcttcgattttcttgaagagttcagatacggttataacaagcttaggtttggagtcatggatttgcctagaga |
27755758 |
T |
|
| Q |
117 |
gttcggagagggtgtataaaggactagaggtggtggcaatagcacctatggcgactatagcaagaaagcaaacagggaagcgtattgagttaggtgctaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27755757 |
gttcggagagggtgtataaaggactagaggtggtggcaatagcacctatggcgactatagcaaggaagcaaacagggaagcgtattgagttaggtgctaa |
27755658 |
T |
|
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
27755657 |
t |
27755657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 57 - 213
Target Start/End: Complemental strand, 27766477 - 27766321
Alignment:
| Q |
57 |
tgaagagttcagatacggttataacaagcttaggtttggagtcatggatttgcctagagagttcggagagggtgtataaaggactagaggtggtggcaat |
156 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||| || | | |||| | | |||||| |||| |||||||||||||||| ||||||||||||| |
|
|
| T |
27766477 |
tgaagagttctgataccgttacaacaagcttaggtttggaatcttcaagttgcttcgtgagttcagagacggtgtataaaggactacaggtggtggcaat |
27766378 |
T |
|
| Q |
157 |
agcacctatggcgactatagcaagaaagcaaacagggaagcgtattgagttaggtgc |
213 |
Q |
| |
|
||||||||||||| | | ||| || ||||| || ||||| ||||| ||||| ||||| |
|
|
| T |
27766377 |
agcacctatggcggcgacagcgaggaagcagacggggaaacgtatggagtttggtgc |
27766321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University