View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7658_low_3 (Length: 283)
Name: NF7658_low_3
Description: NF7658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7658_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 10 - 274
Target Start/End: Original strand, 54724270 - 54724534
Alignment:
| Q |
10 |
ttttgctcgttgtgcctaacacgatgtgcttgacaatgatgatacgatagaagggaaagttgttacannnnnnngttcatttcattgatttgaaattcaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54724270 |
ttttgctcgttgtgcctaacacgatgtgcttaacaatgatgatacgatagaagggaaagttgttacatttttttgttcatttcattgatttgaaattcaa |
54724369 |
T |
|
| Q |
110 |
tatatttggaacaacatcatcatattcctaaccttttgacaacgtacaagacattttagattcatcatatcatgctaaacaatagtaaaataaataaagt |
209 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
54724370 |
tttatttggaacaacatcatcatattcctaactttttgacaacgtacaagacattttagattcatcatatcatgctaaacattagtaaaataaataaaat |
54724469 |
T |
|
| Q |
210 |
agacacatgaagtagctatgtgacagaactatctatcacacagccacaattgttatttatctctg |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
54724470 |
agacacatgaagtagctatgtgacagaactatctaccacatagccacaattgttatttatctctg |
54724534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University