View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7658_low_7 (Length: 234)
Name: NF7658_low_7
Description: NF7658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7658_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 24 - 214
Target Start/End: Complemental strand, 50082986 - 50082796
Alignment:
| Q |
24 |
tgatcaaatgacatgattatcataaaattgaatcgacctacatatatagaaatgagattatcatctcaaactccacaactaatgttattcgctaaccaga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
50082986 |
tgatcaaatgacatgattatcataaaattgaatcgacctacatatatagaaatgagattatcatctcaaacttcacaactaattttattcgctaaccaga |
50082887 |
T |
 |
| Q |
124 |
gataagaataagcttacttggggaaaaaggtttatattttatagtccaaaaataaatggtgggtgttgtcttttcttaattgtcctgcaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082886 |
gataagaataagcttacttggggaaaaaggtttatattttatagtccaaaaataaatggtgggtgttgtcttttcttaattgtcctgcaat |
50082796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University