View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7659_high_4 (Length: 220)
Name: NF7659_high_4
Description: NF7659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7659_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 23 - 207
Target Start/End: Complemental strand, 47144921 - 47144737
Alignment:
| Q |
23 |
agctaaaataaataaagaac-gagtttgatgagttaaaactagggactgagaacaatgattatgttttatgtgtggttggttcaaagggtatatgctagt |
121 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47144921 |
agctaaaataaataaagaactgagtttgatgagttaaaactagggactgagaacaatgattatgttttatgtgtggttggttcaaagggtatatgctagt |
47144822 |
T |
|
| Q |
122 |
gccatcnnnnnnnnncccatcatggtctaatttttgcttaacaatatcgatattttgtcatttatacattagtatatttgtaaata |
207 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47144821 |
gccatc-ttttttttcccatcatggtctaatttttgcttaataatatcgatattttgtcatttatacattagtatatttgtaaata |
47144737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University