View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7660_high_25 (Length: 257)
Name: NF7660_high_25
Description: NF7660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7660_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 43454800 - 43454984
Alignment:
| Q |
18 |
tataatagtagtaattcactacgccaattatttccagcctttcttaagaccatggcgtcccgtcgccataaaatttcatgtctcaaagaaatccataggg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43454800 |
tataatagtagtaattcactacgccaattatttccagcctttcttaagaccatggcgtcccgtcgccataaaatttcatgtctcaaataaatccataggg |
43454899 |
T |
 |
| Q |
118 |
tgaaacattgtccacattcatgcaatgcctatggccaatgtcttgagctgtataacccacatatttgtttaatactcgtagatga |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43454900 |
tgaaacattgtccacattcatgcaatgcctatggccaatgtcttgagctgtataacccaaatatttgtttaatactcgtagatga |
43454984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University