View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7660_high_28 (Length: 249)
Name: NF7660_high_28
Description: NF7660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7660_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 49301739 - 49301505
Alignment:
| Q |
1 |
tgtgtcgtggaagcgttcaattaaaatataatgcagggttttaaaaaatgttttcgagcacaatcaaggctacgacattaaggnnnnnnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49301739 |
tgtgtcgtggaagcgttcaattaaaatataatgcagggttttaaaaaatgttttcgagcacaatcaaggctgcgacattaaggtttttattttatttttt |
49301640 |
T |
 |
| Q |
101 |
ngcaacctcaacatcaatctgcatttgaccgtagttattcgcaatgttaaggattgcggtatgaccgcgattaaaatgatggcataccttcaaattggaa |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301639 |
tgcaacctcgacatcaatctgcatttgaccgttgttattcgcaatgttaaggattgcggtatgaccgcgattaaaatgatggcataccttcaaattggaa |
49301540 |
T |
 |
| Q |
201 |
ttcatgtattttgcttctttgtttaatttgatgat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301539 |
ttcatgtattttgcttctttgtttaatttgatgat |
49301505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University