View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7660_high_36 (Length: 237)
Name: NF7660_high_36
Description: NF7660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7660_high_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 41258586 - 41258786
Alignment:
| Q |
19 |
tattacggaacatcttatcctcaataggttaagcaattgctttannnnnnnaatactgaattcctaggttgatattatagtttcttgcacttttggcttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41258586 |
tattacggaacatcttatcctcaataggttaagcaattgctttatttttt-aatactgaattcctaggttgatattatagtttcttgcacttttggcttt |
41258684 |
T |
|
| Q |
119 |
cggttatagaagcagaacttgttttagtgttcactaagattatatgaaaggaattagattaaacatttaagaatcacaaggattgttcgtcatgatcatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41258685 |
cggttatagaagcagaacttgttttagtgttcactaagattatatgaaaggaattagattaaacatttaagaatcacaaggattgttcgtcatgatcatc |
41258784 |
T |
|
| Q |
219 |
tt |
220 |
Q |
| |
|
|| |
|
|
| T |
41258785 |
tt |
41258786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University