View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7660_low_21 (Length: 347)
Name: NF7660_low_21
Description: NF7660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7660_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 5852288 - 5851959
Alignment:
| Q |
1 |
tcttacacaacaatattaccgtttatgccggttgagctccgttcttgataaagttgcatcgctctgatttccccttgaacgcactgtgatgcttgttcaa |
100 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| ||| |||||||||||||||||||| |||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
5852288 |
tcttacataacaatattatcgtttatgccggttgaactctgttcttgataaagttgcatcactctgattgccccttgaacccactatgatgcttgttcaa |
5852189 |
T |
|
| Q |
101 |
cccttgaatggtcggtagaattatatgttttgagttcacttagacatttaactgaaagatatgttgaggtgacaaattatccaatgaaaactgaaagagt |
200 |
Q |
| |
|
||||||||||||||||||||| | |||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5852188 |
cccttgaatggtcggtagaatcacatgtgttgagttcacttggacatttaactgaaagatatgttgaggtgacaaatgatccaatgaaaactgaaagagt |
5852089 |
T |
|
| Q |
201 |
ctctaatcttatacaacgtatgcgctccctcttatccgttcgactgtgctacactttcatgtattataggccgtttagttggtattaagaacatggttgg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5852088 |
ctctaatcttatacaacgtatgcgctccctcttatccgttcgagtgtgctacactttcatgtatgataggccgtttagttggtattaagaacatggttgg |
5851989 |
T |
|
| Q |
301 |
catccctcacttcgaaaatgatgcaagaac |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5851988 |
catccctcacttcgaaaatgatgcaagaac |
5851959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University