View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7660_low_25 (Length: 278)
Name: NF7660_low_25
Description: NF7660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7660_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 261
Target Start/End: Original strand, 49301805 - 49302052
Alignment:
| Q |
14 |
gaaccaacatgttaacaatgtaaagtatctaaggtggatgctagaggtaaattcaaaacaatattaatatactcattatcattcttcaatatttatacca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301805 |
gaaccaacatgttaacaatgtaaagtatctaaggtggatgctagaggtaaattcaaaacaatattaatatactcattatcattcttcaatatttatacca |
49301904 |
T |
 |
| Q |
114 |
ttattagaatataatcaaatagttaactttcannnnnnnnattattgattattttacagaccattccagaccaaattctagagagtcaccaattatctgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301905 |
ttattagaatataatcaaatagttaactttcattttttttattattgattattttacagaccattccagaccaaattctagagagtcaccaattatctgg |
49302004 |
T |
 |
| Q |
214 |
tatcacactagaatatagaagggaatgtggaagttcagatatagttca |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49302005 |
tatcacactagaatatagaagggaatgtggaagttcagatatagttca |
49302052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University