View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7660_low_38 (Length: 233)
Name: NF7660_low_38
Description: NF7660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7660_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 17437330 - 17437530
Alignment:
| Q |
14 |
attattctccatgtgtatgacactgtaaagagaaaatatttcataaccacaagactggcaagactgaaaattgaacttacaatgcatcttcgtagtgagt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17437330 |
attattctccatgtgtatgacactgtaaatagaaaatatttcataaccacaagactggcaagactgaaaattgaacttacaatgcatcttcgtagtgagt |
17437429 |
T |
 |
| Q |
114 |
gcaaaatcacagcgaacccatcgtgattattcaaaattacactttaaatcttaaaataaaatcgcggtgttatcgcgccagttcattgtgattcttaaga |
213 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17437430 |
gcaaaatcacagcgaccccatagtgattattcaaaattacactttaaatcttaaaacaaaatcatggtgttatcgcaccagttcattgtgattcttaaga |
17437529 |
T |
 |
| Q |
214 |
g |
214 |
Q |
| |
|
| |
|
|
| T |
17437530 |
g |
17437530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University