View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7660_low_41 (Length: 204)
Name: NF7660_low_41
Description: NF7660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7660_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 10668983 - 10669153
Alignment:
| Q |
18 |
gaagaagcaggatcagatctggcagtttccagcaagaacggatgttgtcaagaatgaaaacacaagtttggtatggcttaagaattgaaataaagtggaa |
117 |
Q |
| |
|
||||||| ||||||||||| | |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
10668983 |
gaagaagtaggatcagatccgacagtttccagcaagaacggaagatgtcaagaatgaaaacacaagtttggtatggcttaagaatggaaataaagtgaaa |
10669082 |
T |
|
| Q |
118 |
ggaagaaactgatgtaatggtgaaaatttgagtaatagatttttagataatttggattttggtgatgaaat |
188 |
Q |
| |
|
||||||||||||| ||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10669083 |
ggaagaaactgatttaatgatgaaaatttaagtaatggatttttagataatttggattttggtgatgaaat |
10669153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University