View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7662_high_5 (Length: 239)
Name: NF7662_high_5
Description: NF7662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7662_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42954857 - 42954635
Alignment:
| Q |
1 |
ctatttagagtggaggaaaatcgttattggtttttctttcaactaactattcaacatattaggatgggaaatcatgtgaaatcgttattttcatttctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42954857 |
ctatttagagtggaggaaaatcgttattggtttttctttcaactaactattcaacatattaggatgggaaatcatgtgaaatcgttattttcatttctca |
42954758 |
T |
 |
| Q |
101 |
tatctttaagaaactaaggttatagttgctttctttctattcattattcattcacattatgatttgtcgaatgcatattttaattgatgctactcatgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42954757 |
tatctttaagaaactaaggttatagttgctttctttctattcattattcattcacattatgatttgtcgaatgcatattttaattgatgctactcatgga |
42954658 |
T |
 |
| Q |
201 |
atatatcatgcagatttcaagag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42954657 |
atatatcatgcagatttcaagag |
42954635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 163 - 223
Target Start/End: Complemental strand, 42962167 - 42962107
Alignment:
| Q |
163 |
tttgtcgaatgcatattttaattgatgctactcatggaatatatcatgcagatttcaagag |
223 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
42962167 |
tttgtcgaatgcatattttaattggtggtactcatggaatatatcatgcagatttcaagag |
42962107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University