View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7662_low_3 (Length: 266)

Name: NF7662_low_3
Description: NF7662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7662_low_3
NF7662_low_3
[»] scaffold0565 (1 HSPs)
scaffold0565 (20-254)||(5225-5459)


Alignment Details
Target: scaffold0565 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: scaffold0565
Description:

Target: scaffold0565; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 20 - 254
Target Start/End: Original strand, 5225 - 5459
Alignment:
20 tgcaactccaattccactccacaaactcaaaaccaacactactatccctatattcatcatagagaggtccaaaaatgccattgaaaaatgaggtaaataa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5225 tgcaactccaattccactccacaaactcaaaaccaacactactatccctatattcatcatagagaggtccaaaaatgccattgaaaaatgaggtaaataa 5324  T
120 ttgtaatggctaatggggtgtgtgtggaaagagagagggaattggatgatgaaaatgtgaaatgagcaaagctatatatgtagtggtggatgaggcaaag 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5325 ttgtaatggctaatggggtgtgtgtggaaagagagagggaattggatgatgaaaatgtgaaatgagcaaagctatatatgtagtggtggatgaggcaaag 5424  T
220 atttctaaaggcttttacgtatggttgaggatatt 254  Q
    ||||||||||||||||||||| |||||||||||||    
5425 atttctaaaggcttttacgtacggttgaggatatt 5459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University