View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7662_low_4 (Length: 249)
Name: NF7662_low_4
Description: NF7662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7662_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 23182670 - 23182761
Alignment:
| Q |
18 |
gagtatacatttgagaattagagtttgtgttccagtaagaattctgattgagatgaatcttctgattcagcatttgaaaatatttttcaaac |
109 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23182670 |
gagtatacatttgagaattagagttggtgttccagtaagaattctgattgagatgaatcttctgattcagcatttgaaaatatttttcaaac |
23182761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University