View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_high_35 (Length: 357)
Name: NF7665_high_35
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_high_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 3243186 - 3242949
Alignment:
| Q |
1 |
accagagttgttctcgttcccttttggattcataacaatccgcctgaaaaacaacatcgaaaacatnnnnnnnnnnnnnnnnnnnnn-catgacaatgat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3243186 |
accagagttgttctcgttcccttttggattcataacaatccgcctgaaaaacaacatcgaaaacataaaaaaaaaaaagtgtaaaaaacatgacaatgat |
3243087 |
T |
 |
| Q |
100 |
gattacgttggaaactggaattcactcgatcaccaaccatggatagccattcaagaaaaagctgtctgagtacatctgagaatcacacttagagaagttc |
199 |
Q |
| |
|
|||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3243086 |
gattacataggaaactggaattcaatcgatcaccaaccatggatagccattcaagaaaaagctgtctgagtacatctgagaatcacacttagagaagttc |
3242987 |
T |
 |
| Q |
200 |
ttaatcgtccatgtgaattgctcaatcgtccatgggga |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3242986 |
ttaatcgtccatgtgaattgctcaatcgtccatgggga |
3242949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 259 - 330
Target Start/End: Complemental strand, 3242966 - 3242895
Alignment:
| Q |
259 |
ctcaatcgtccatggggaccatggggatatattctccatctcagcagcctaacagcttcaactctaacacca |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3242966 |
ctcaatcgtccatggggaccatggggatatgttctccatctcagcagcctaacagcttcaactctaacacca |
3242895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 164 - 257
Target Start/End: Complemental strand, 3238887 - 3238794
Alignment:
| Q |
164 |
tctgagtacatctgagaatcacacttagagaagttcttaatcgtccatgtgaattgctcaatcgtccatggggatatattctcaaatgctttac |
257 |
Q |
| |
|
||||||||| ||| ||||||||| || |||||||| ||||||||||||||||||||||||||||||| ||||||| | ||||||| |||||||| |
|
|
| T |
3238887 |
tctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctggggatttcttctcaattgctttac |
3238794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 3239035 - 3238977
Alignment:
| Q |
7 |
gttgttctcgttcccttttggattcataacaatccgcctgaaaaacaacatcgaaaacat |
66 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
3239035 |
gttgttcttgctcccttttggattcataacaatccgcctgaaaaa-aatatcgaaaacat |
3238977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University