View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_high_44 (Length: 293)
Name: NF7665_high_44
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 55910733 - 55911004
Alignment:
| Q |
1 |
tttgattgtgcagttttgtttcataggatctttcttgctatgttagtttgtggctggattgagttttctttgccacatccttttaatcgaatattgttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55910733 |
tttgattgtgcagttttgtttcataggatctttcttgctatgttagtttgtggctggattgagttttctttgccacatccttttaatcgaatattgttac |
55910832 |
T |
 |
| Q |
101 |
tttccctagcnnnnnnnnccgctatgattatttttgtagatctgttattgctccaaactgctgaatcaaataaagatatattcacacctgatatcacagt |
200 |
Q |
| |
|
||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55910833 |
ttttcctagcttttttttccgctatgattatttttgtagatctgttattgctccaaactgctgaatcaaataaagatatattcacacctgatatcacagt |
55910932 |
T |
 |
| Q |
201 |
gttcagtcagtgctccaatttttaaactcaagctggcttaaaagatttgccgcaactttgaatatacggggtaata |
276 |
Q |
| |
|
| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55910933 |
----attcagtgctccattttttaaactcaagctggcttaaaagatttgccgcaactttgaatatacggggtaata |
55911004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University