View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7665_high_50 (Length: 265)

Name: NF7665_high_50
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7665_high_50
NF7665_high_50
[»] chr4 (1 HSPs)
chr4 (54-251)||(55915930-55916128)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 54 - 251
Target Start/End: Original strand, 55915930 - 55916128
Alignment:
54 taattagggtaatctttttctcctttagaaaa-aacttggtaccacctaaaatacaaaaccaggagaagaagaattgaggttacatatagacttaacaaa 152  Q
    |||||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||    
55915930 taattaggctcatctttttctcctttagaaaaaaacttggtaccacctaaaatacaaaactaggagaagaagaattgaggttgcatatagacttaacaaa 55916029  T
153 ttaggttccaatctagttgaaaatgtgtccatatttaaaatccaacaatgtctcaagtaatattagataccatatgtataatgttcacatttattggtt 251  Q
    ||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |||||| |||||||    
55916030 ttaggtttcaatttagttgaaaatgtgtccatatttaaaatccgacaatgtctcaagtaatattacatacgatatgtataatgtccacattcattggtt 55916128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University