View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_high_56 (Length: 253)
Name: NF7665_high_56
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_high_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 218
Target Start/End: Complemental strand, 45310739 - 45310531
Alignment:
| Q |
10 |
aagaatattaattaagatgcactcacgataatgcttaaaggggcagcaaaaacactagtagcaaaaactacacaaatccatccaagaagcttgatacgtc |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310739 |
aagaatgttaattaagatgcactcacgataatgcttaaaggggcagcaaaaacactagtagcaaaaactacacaaatccatccaagaagcttgatacgtc |
45310640 |
T |
 |
| Q |
110 |
cttcttcttgttttgctaggaagtgagttaacaagacaatcgtgccaaatcccacaaagttcattaacacaatcatcctcaatgttgacatctacataag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310639 |
cttcttcttgttttgctaggaagtgagttaacaagacaatcgtgccaaatcccacaaagttcatcaacacaatcatcctcaatgttgacatctacataag |
45310540 |
T |
 |
| Q |
210 |
aacaatttt |
218 |
Q |
| |
|
||||||||| |
|
|
| T |
45310539 |
aacaatttt |
45310531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University