View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_low_33 (Length: 361)
Name: NF7665_low_33
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 93 - 343
Target Start/End: Complemental strand, 48457774 - 48457525
Alignment:
| Q |
93 |
aagtggtaaattatgaagagagatataggaaattaaaggaatggagaaaaggtgaggaattatgataactagtagaggtgtggggtgggagaaggtatag |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48457774 |
aagtggtaaattatgaagagagatataggaaattaaaggaatggagaaaaggtgaggaattatgataactagtagaggtgtggtgtgggagaaggtatag |
48457675 |
T |
 |
| Q |
193 |
gtatcaaaatatcagaattctttaaaataannnnnnnnncatgatacaactttaaaatgatttattaatggatggctggacttgcgaccgtacataatac |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48457674 |
gtatcaaaatatcagaattctttaaaataa-ttttttttcatgatacaactttaaaatgatttattaatggatggctggacttgcgaccgtacataatac |
48457576 |
T |
 |
| Q |
293 |
atgcatgtatcggtaccaagtatgtgtaactagtaaacttacttgctggtt |
343 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48457575 |
atgcatgtatcggtacgaagtatgtgtaactagtaaacttacttgctggtt |
48457525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 13 - 83
Target Start/End: Complemental strand, 48457828 - 48457758
Alignment:
| Q |
13 |
aatatcaccccaaaacttatttattctttttatacatagtatagatataaactcaagtggtaaattatgaa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48457828 |
aatatcaccccaaaacttatttattctttttatacatagtatagatataaactcaagtggtaaattatgaa |
48457758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University