View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_low_38 (Length: 340)
Name: NF7665_low_38
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 17 - 324
Target Start/End: Original strand, 37215547 - 37215854
Alignment:
| Q |
17 |
aattatcaggtggtataggtgaaggatgatgtttaggcaaagccttggcaatgatgataggaagaccaattgcacaaaaacccacaaagattataccaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215547 |
aattatcaggtggtataggtgaaggatgatgtttaggcaaagccttggcaatgatgataggaagaccaattgcacaaaaacccacaaagattataccaaa |
37215646 |
T |
|
| Q |
117 |
aatccatttcaatgccttgtgactcaacacgatgcatccaaaatccacatacttggtcttcttcttcatatttggcctttcaagaatccagctttgtagt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215647 |
aatccatttcaatgccttgtgactcaacacgatgcatccaaaatccacatacttggtcttcttcttcatatttggcctttcaagaatccagctttgtagt |
37215746 |
T |
|
| Q |
217 |
gtctcatccaatccctcgcgtcgattaccatgatctagcaacgctgccttgtcccattgatctccggtgcggctggtctcatcgcccgatggcacttcac |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37215747 |
gtctcatccaatccctcgcgtcgattaccatgatcgagcaacgctgccttgtcccattgatctccggtgcggctggtctcatctcccgatggcacttcac |
37215846 |
T |
|
| Q |
317 |
tattgctg |
324 |
Q |
| |
|
|||||||| |
|
|
| T |
37215847 |
tattgctg |
37215854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University