View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_low_39 (Length: 331)
Name: NF7665_low_39
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 7 - 312
Target Start/End: Original strand, 43396257 - 43396562
Alignment:
| Q |
7 |
aggagtatagtcttaatgggtttttgaaagagcagaggaatttgtttcagagattctcgaagggagagcttcatacaaatgtcgaaatcaaaattgtgct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396257 |
aggagtatagtcttaatgggtttttgaaagagcagaggaatttgtttcagagattctcgaagggagagcttcatacaaatgtcgaaatcaaaattgtgct |
43396356 |
T |
 |
| Q |
107 |
ttctgggcatttaaacagttagtgaaaaacttgaatgcatgttttctatcatgctaaatttgtcggaatcactgtgagcattataattttcaaaagctac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396357 |
ttctgggcatttaaacagttagtgaaaaacttgaatgcatgttttctatcatgctaaatttgtcggaatcactgtgagcattataattttcaaaagctac |
43396456 |
T |
 |
| Q |
207 |
ggtagctcgctgtgattttgataaactcacgtgagaccaagcatggactgaatttgttttgttgatttgattttgggagtgttggaaagtgtggaattta |
306 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396457 |
ggtagctcactgtgattttgataaactcacgtgagaccaaacatggactgaatttgttttgttgatttgattttgggagtgttggaaagtgtggaattta |
43396556 |
T |
 |
| Q |
307 |
tttgta |
312 |
Q |
| |
|
|||||| |
|
|
| T |
43396557 |
tttgta |
43396562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University