View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_low_50 (Length: 271)
Name: NF7665_low_50
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_low_50 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 12 - 271
Target Start/End: Original strand, 55910476 - 55910735
Alignment:
| Q |
12 |
aagaaacaaagccttgtatccattttcattttcccatcaaagttgtacattattcacatttgcatcattttattcccctttaaccaatttatccactgtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55910476 |
aagaaacaaagccttgtatccattttcattttcccatcaaagttgtacattattcacatttgcatcattttattcccctttaaccaatttgtccactgtt |
55910575 |
T |
 |
| Q |
112 |
tcaaatttgatggggggcttaggaatgaggttcttattttagcaggtgtatcagggagtaaaagtttgacagctttattctcgtgtctaggacccatgtt |
211 |
Q |
| |
|
||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55910576 |
tcaaatttgatggggggtttaggaatgaagctcttattttagcaggtgtatcagggagtaaaagtttgacagctttattctcgtgtctaggacccatgtt |
55910675 |
T |
 |
| Q |
212 |
ttccttgcttaattatgcaggttatgggtggggcgtgactggcattttgttcttagtttt |
271 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55910676 |
ttccttgcttaattatgcaggttgtgggtggggcgtgattggcattttgttcttagtttt |
55910735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University