View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_low_52 (Length: 265)
Name: NF7665_low_52
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 54 - 251
Target Start/End: Original strand, 55915930 - 55916128
Alignment:
| Q |
54 |
taattagggtaatctttttctcctttagaaaa-aacttggtaccacctaaaatacaaaaccaggagaagaagaattgaggttacatatagacttaacaaa |
152 |
Q |
| |
|
|||||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55915930 |
taattaggctcatctttttctcctttagaaaaaaacttggtaccacctaaaatacaaaactaggagaagaagaattgaggttgcatatagacttaacaaa |
55916029 |
T |
 |
| Q |
153 |
ttaggttccaatctagttgaaaatgtgtccatatttaaaatccaacaatgtctcaagtaatattagataccatatgtataatgttcacatttattggtt |
251 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |||||| ||||||| |
|
|
| T |
55916030 |
ttaggtttcaatttagttgaaaatgtgtccatatttaaaatccgacaatgtctcaagtaatattacatacgatatgtataatgtccacattcattggtt |
55916128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University