View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_low_55 (Length: 264)
Name: NF7665_low_55
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 45310969 - 45311226
Alignment:
| Q |
1 |
tatgtggtttaaacttttttagtatagtg----tatctactatgaaaatgtctttctctaatgacgcgtgacgtaacagaatttcaaacatttgttttat |
96 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310969 |
tatgttgtttaaacttttttagtatagtgagtgtatctactatgaaaatgtctttctctaatgacgcgtgacgtaacagaatttcaaacatttgttttat |
45311068 |
T |
 |
| Q |
97 |
gtttgcatttgtattaattaattgctattttgtctttatggaataatacataacaaaacttatgnnnnnnnnnnnnnatggacagctcccgaacgttgtg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45311069 |
gtttgcatttgtattaattaattgctattttgtctttatggaataatacataacaaaacttatgtttttttttttttatggacagctcccgaacgttgtg |
45311168 |
T |
 |
| Q |
197 |
gggttaacatttggaatagttcagatcacactctatgcaatgtacagaaacaccaaac |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45311169 |
gggttaacatttggaatagttcagatcacactctatgcaatgtacagaaacagcaaac |
45311226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University