View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_low_60 (Length: 249)
Name: NF7665_low_60
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 234
Target Start/End: Complemental strand, 2764757 - 2764535
Alignment:
| Q |
12 |
atgaacacgagaatctcacaagctgatgtagtacaccccgatgaaatggatgaggaatttgatacttttccaacaagcaaaaatcccgaccttgtaagaa |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2764757 |
atgaacacaagaatctcacaagctgatgtagtacaccccgatgaaatggatgaggaatttgatacttttccaacaagcaaaaatcccgaccttgtaagaa |
2764658 |
T |
 |
| Q |
112 |
tgcggtatgatcgtttgaggagtgtggctggtagaatacaaacggttgtaggtgatttggctagccagggtgagaggattcatgcactgttgagctggag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2764657 |
tgcggtatgatcgtttgaggagtgtggctggtagaatacaaaccgttgtaggtgatttggctagccagggtgagaggattcatgcactgttgagctggag |
2764558 |
T |
 |
| Q |
212 |
agatccgcgtgctacttctttat |
234 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2764557 |
agatccgcgtgctacttctttat |
2764535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University