View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7665_low_66 (Length: 229)

Name: NF7665_low_66
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7665_low_66
NF7665_low_66
[»] chr3 (2 HSPs)
chr3 (110-229)||(45386254-45386375)
chr3 (112-215)||(45390626-45390734)
[»] chr4 (1 HSPs)
chr4 (112-215)||(734233-734341)


Alignment Details
Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 110 - 229
Target Start/End: Complemental strand, 45386375 - 45386254
Alignment:
110 cccatttgcagcctcagattgtgactgttgttaaaattcacatgcattgtgaagcttgtgcacaggagataa--aaaaggatactgaaaatgaagggtac 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||    
45386375 cccatttgcagcctcagattgtgactgttgttaaaattcacatgcattgtgaagcttgtgcacaggagataaaaaaaaggatactgaaaatgaagggtac 45386276  T
208 tgtacaatatttaagtgttttt 229  Q
    |||||||||||||||| |||||    
45386275 tgtacaatatttaagtcttttt 45386254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 112 - 215
Target Start/End: Complemental strand, 45390734 - 45390626
Alignment:
112 catttgcagcctcagattgtga---ctgttgttaaaattcacatgcattgtgaagcttgtgcacaggagat--aaaaaaggatactgaaaatgaagggta 206  Q
    ||||||||||||||||||||||   ||||  ||||| |||||||||||||||||||||||||| |||| ||  ||||| ||||||| |||||||| ||||    
45390734 catttgcagcctcagattgtgattactgtccttaaagttcacatgcattgtgaagcttgtgcagaggaaatcaaaaaacggatacttaaaatgaatggta 45390635  T
207 ctgtacaat 215  Q
    |||| ||||    
45390634 ctgtccaat 45390626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 112 - 215
Target Start/End: Complemental strand, 734341 - 734233
Alignment:
112 catttgcagcctcagattgtga---ctgttgttaaaattcacatgcattgtgaagcttgtgcacaggagat--aaaaaaggatactgaaaatgaagggta 206  Q
    ||||||||||||||||||||||   ||||  ||||| |||||||||||||||||||||||||| |||| ||  ||||| ||||||| |||||||| ||||    
734341 catttgcagcctcagattgtgattactgtccttaaagttcacatgcattgtgaagcttgtgcagaggaaatcaaaaaacggatacttaaaatgaatggta 734242  T
207 ctgtacaat 215  Q
    |||| ||||    
734241 ctgtccaat 734233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University