View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7665_low_68 (Length: 225)

Name: NF7665_low_68
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7665_low_68
NF7665_low_68
[»] chr7 (2 HSPs)
chr7 (35-216)||(9431863-9432044)
chr7 (88-216)||(6691139-6691267)
[»] chr6 (2 HSPs)
chr6 (88-216)||(797559-797687)
chr6 (88-216)||(8272140-8272268)
[»] chr5 (1 HSPs)
chr5 (88-216)||(19943084-19943212)


Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 35 - 216
Target Start/End: Complemental strand, 9432044 - 9431863
Alignment:
35 tttccgttttattaaagagatttgtagcatcccgaagacgtatgcataatttttgtagttgagcgtatgagtagaacattgaatgagagatcgagaagca 134  Q
    ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9432044 tttccgttttattaaagagatttgtagcatcccgaagacataggcataatttttgtagttgagcgtatgagtagaacattgaatgagagatcgagaagca 9431945  T
135 tgcatgtgcacacaggcttaccaaagtggttctgtacagaagcagttaacacattagcttacttaatcaactgatgtccatc 216  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||    
9431944 tgcatgtgcacgcaggcttaccaaagtggttctgtacggaagcagttaacacattagcttacttaatcaactgaggtccatc 9431863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 88 - 216
Target Start/End: Original strand, 6691139 - 6691267
Alignment:
88 tgtagttgagcgtatgagtagaacattgaatgagagatcgagaagcatgcatgtgcacacaggcttaccaaagtggttctgtacagaagcagttaacaca 187  Q
    ||||| ||||||||||| ||||||||||| ||||||| | |||||| ||| |||||   ||||||||||||||   |||||  |||||||||| ||||||    
6691139 tgtagctgagcgtatgaatagaacattgactgagagagccagaagcttgcgtgtgcgttcaggcttaccaaagaacttctgggcagaagcagtcaacaca 6691238  T
188 ttagcttacttaatcaactgatgtccatc 216  Q
    | || ||||||||||||| || |||||||    
6691239 tcagattacttaatcaaccgaggtccatc 6691267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 88 - 216
Target Start/End: Complemental strand, 797687 - 797559
Alignment:
88 tgtagttgagcgtatgagtagaacattgaatgagagatcgagaagcatgcatgtgcacacaggcttaccaaagtggttctgtacagaagcagttaacaca 187  Q
    ||||| ||||||||||| ||||||||||| ||||||| | |||||| ||| ||||||  ||||||||||||||   |||||  |||||||||| ||||||    
797687 tgtagctgagcgtatgaatagaacattgactgagagagccagaagcttgcgtgtgcagtcaggcttaccaaagaaattctgggcagaagcagtcaacaca 797588  T
188 ttagcttacttaatcaactgatgtccatc 216  Q
    | |||||||||||||||| || |||||||    
797587 tcagcttacttaatcaaccgaggtccatc 797559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 88 - 216
Target Start/End: Original strand, 8272140 - 8272268
Alignment:
88 tgtagttgagcgtatgagtagaacattgaatgagagatcgagaagcatgcatgtgcacacaggcttaccaaagtggttctgtacagaagcagttaacaca 187  Q
    ||||||||||||||||| ||||||||||| ||||||| | |||||| ||| ||||||  ||||||||||||||   |||||  || ||||||| ||||||    
8272140 tgtagttgagcgtatgaatagaacattgactgagagagccagaagcttgcgtgtgcagtcaggcttaccaaagaacttctgggcaaaagcagtcaacaca 8272239  T
188 ttagcttacttaatcaactgatgtccatc 216  Q
    | |||||||||||||||| || |||||||    
8272240 tcagcttacttaatcaaccgaggtccatc 8272268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 88 - 216
Target Start/End: Original strand, 19943084 - 19943212
Alignment:
88 tgtagttgagcgtatgagtagaacattgaatgagagatcgagaagcatgcatgtgcacacaggcttaccaaagtggttctgtacagaagcagttaacaca 187  Q
    ||||| ||||||||||| ||||||||||| ||||||| | |||||| ||| ||||||  ||||||||||||||   |||||  |||||||||| ||||||    
19943084 tgtagctgagcgtatgaatagaacattgactgagagagccagaagcttgcgtgtgcagtcaggcttaccaaagaacttctgggcagaagcagtcaacaca 19943183  T
188 ttagcttacttaatcaactgatgtccatc 216  Q
    | |||||||||||||||| || |||||||    
19943184 tcagcttacttaatcaaccgaggtccatc 19943212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University