View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7665_low_70 (Length: 210)
Name: NF7665_low_70
Description: NF7665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7665_low_70 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 33175513 - 33175342
Alignment:
| Q |
1 |
ttaaattttaaaaattgcttaaatgggaaattgctttgagtagtttatctataaaattgcttataaaaagagttggagaacgatggatttttattacagt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33175513 |
ttaaattttgaaaattgcttaaatgggaaattgctttgagtagcttatctataaaattgcttataaaaagagttggagaacgatggatttttattacagt |
33175414 |
T |
|
| Q |
101 |
gacattaatggttattttactactatatatatccaaggagatttgaacttaatgtcttgatattacaatgat |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33175413 |
gacattaatggttattttactactatatatatccaaggagatttgaacttaatgtcttgatattacaatgat |
33175342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University