View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7666_high_12 (Length: 320)
Name: NF7666_high_12
Description: NF7666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7666_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 4 - 153
Target Start/End: Complemental strand, 2914475 - 2914322
Alignment:
| Q |
4 |
tgagcgttatttgggattgagat-ttttggaagaaaat--tataacttgtaaatttaccaagtgtgattggacggtttgatttcatcttaattttgttgt |
100 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2914475 |
tgagtgttatttgggattgagatcttttggaagaaaatattataacttgtaaatttaccaagtgtgattggacggtttgatttcatcttaattttgttgt |
2914376 |
T |
 |
| Q |
101 |
tttnnnnnnntcgcgcttgattgtttctaaattctaatatt-cggattttatat |
153 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2914375 |
tttaaaaaaatcgcgcttgattgtttctaaattctaatattggggattttatat |
2914322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 145 - 228
Target Start/End: Complemental strand, 2914137 - 2914054
Alignment:
| Q |
145 |
attttatatttatgcgacaattttgggattaagtttgctgaattttcggtaattttgttccagtacatgtgtgataactgatag |
228 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2914137 |
attttatatttatgcgacaattttaggattaagtttgctgaattttcggtagttttgttccagtacatgtgtgataactgatag |
2914054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University