View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7666_low_11 (Length: 332)
Name: NF7666_low_11
Description: NF7666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7666_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 19 - 326
Target Start/End: Complemental strand, 28314697 - 28314388
Alignment:
| Q |
19 |
catattacttaaatattttattttgataattcacttaattgtaattatacaatctcctctcatgaaatggtactatcac--ctacgtccataccttaatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28314697 |
catattacttaaatattttattttgataattcacttaattgtaattatacaatctcgtctcatgaaatggtactatcacacctacgtccataccttaatc |
28314598 |
T |
 |
| Q |
117 |
atatttacttgagagatttaattgaacatgaaggtgctgcatatctagctgaaaatctacggtacgattcttcgtcgtcctccatcaaaccctcatcaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28314597 |
atatttacttgagagatttaattgaacatgaaggtgctgcatatctagctgaaaatctacggcacgattcttcgtcgtcctccatcaaaccctcatcaaa |
28314498 |
T |
 |
| Q |
217 |
gttctgagaatagcttaaaggatcataaccaaagccaccagttgatttgttgcaagtgttttttctctttgtccaaggaagcttcaatttgaaacatccc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28314497 |
gttctgagaatagcttaaaggatcataaccaaagccaccggttgatttgttgcaagtgttttttctctttgtccaaggaagcttcaatttgaaacatccc |
28314398 |
T |
 |
| Q |
317 |
caacacgaaa |
326 |
Q |
| |
|
||||| |||| |
|
|
| T |
28314397 |
caacatgaaa |
28314388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University