View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7666_low_17 (Length: 206)
Name: NF7666_low_17
Description: NF7666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7666_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 65 - 191
Target Start/End: Original strand, 39501175 - 39501301
Alignment:
| Q |
65 |
gaactacaatacaattatctgaccttgatgaagcagaaaacatgttttgttaaattacattaatttggaaaaggcctgctgattagaaccctaataatct |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39501175 |
gaactacaatacaattatctgaccttgatgaagcagaaaacgtgttttgttaaattacattaatttggaaaaggcctgctgattagaaccctaataatct |
39501274 |
T |
 |
| Q |
165 |
cttgtgcttataacacaagataatgat |
191 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39501275 |
cttgtgcttataacacaagataatgat |
39501301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University