View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7668_low_2 (Length: 241)
Name: NF7668_low_2
Description: NF7668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7668_low_2 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 7488333 - 7488093
Alignment:
| Q |
1 |
catcaaatccctcttttccaacagcaattgtcgcacttttataagaatggaatcatatggtagttgcaatggcgttttctgtctccaaggtttgtgttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7488333 |
catcaaatccctcttttccaacagcaattgtcgcacttttataagaatggaatcatatggtagttgcaatggcgttttctgtctccaaggtttgtgttgg |
7488234 |
T |
 |
| Q |
101 |
tttcataagagttgtcttgatgagttaattatgtggaacccaacaactagagaggtccatcgtgttcctccgagtctctgccttgacaacgactcatgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7488233 |
tttcataagagttgtcttgatgagttaattatgtggaaccctacaactagagaggtccaccgtgttcctccgagtctctgccttgataacgactcatgca |
7488134 |
T |
 |
| Q |
201 |
tgtatggttttggtgccgatgatcccaacaacatcaacttc |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7488133 |
tgtatggtttcggtgccgatgatcccaacaacatcaacttc |
7488093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 110 - 230
Target Start/End: Complemental strand, 7475354 - 7475234
Alignment:
| Q |
110 |
agttgtcttgatgagttaattatgtggaacccaacaactagagaggtccatcgtgttcctccgagtctctgccttgacaacgactcatgcatgtatggtt |
209 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||| || | | |||||| || | | | |||| |||||||||| |
|
|
| T |
7475354 |
agttgtctagatgagttaattatttggaacccaacaactagagaggtccatcgtattccccctactagctgcctcgataccaaatcatctatgtatggtt |
7475255 |
T |
 |
| Q |
210 |
ttggtgccgatgatcccaaca |
230 |
Q |
| |
|
||||||| |||||||| |||| |
|
|
| T |
7475254 |
ttggtgcagatgatccaaaca |
7475234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 40 - 101
Target Start/End: Complemental strand, 7475457 - 7475396
Alignment:
| Q |
40 |
tataagaatggaatcatatggtagttgcaatggcgttttctgtctccaaggtttgtgttggt |
101 |
Q |
| |
|
||||| ||| |||||||||||||||| |||||| |||||||||||| ||||||||||||||| |
|
|
| T |
7475457 |
tataacaattgaatcatatggtagtttcaatggtgttttctgtctcaaaggtttgtgttggt |
7475396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University