View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7669_low_3 (Length: 214)
Name: NF7669_low_3
Description: NF7669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7669_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 33890290 - 33890492
Alignment:
| Q |
1 |
tttttgaccaaatattaatattattactctttaatatttgtagcataaatttacatcttttaaatcacacagagttgtgcaaagcattccttacatacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||| ||||||||| |
|
|
| T |
33890290 |
tttttgaccaaatattaatattattactctttaatatttgtagcataaattcacatcttttaaatcaca--gagttatgcaaagcattccctacatacaa |
33890387 |
T |
|
| Q |
101 |
ttatagcatttgctctttttgttttaaaaaggcaagaaaattgtaggagtttcatcacattatgctaattccctaaatagatagatgacatggttatagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33890388 |
ttatagcatttgctctttttgttttaaaaaggcaagaaaattgtaggagtttcatcacattatgctaattccctaaatagataaatgacatggttatagt |
33890487 |
T |
|
| Q |
201 |
attat |
205 |
Q |
| |
|
||||| |
|
|
| T |
33890488 |
attat |
33890492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University