View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7670_high_5 (Length: 271)
Name: NF7670_high_5
Description: NF7670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7670_high_5 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 95 - 271
Target Start/End: Complemental strand, 52764586 - 52764410
Alignment:
| Q |
95 |
tcttctgggtactaacaagtccattattccaacatgtttaactggtacctcaaaataggccccatattgagtacttttgagatgtcnnnnnnngtccgaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52764586 |
tcttctgggtactaacaagtccattattccaacatgtttaactggtacctcaaaataggccccatattgagtacttttgagatgtctttttttgtccgaa |
52764487 |
T |
 |
| Q |
195 |
gttttgaattatggttcacactattcagtttcaatcaaatcaatgcttgtggaaccgtagatccggataaactctat |
271 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52764486 |
gttttgaattatgtttcacactattcagtttcaatcaaatcaatgcttgtggaaccgtagatccggataaactctat |
52764410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 135 - 264
Target Start/End: Complemental strand, 52770536 - 52770404
Alignment:
| Q |
135 |
actggtacctcaaaataggccccatattgagtacttttgagatg---tcnnnnnnngtccgaagttttgaattatggttcacactattcagtttcaatca |
231 |
Q |
| |
|
|||||||| | ||||||||||||||| ||||||||||||||||| | ||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52770536 |
actggtacttaaaaataggccccatactgagtacttttgagatggattttttttttgtctgaagttttgaattatgtttcacactattcagtttcaatca |
52770437 |
T |
 |
| Q |
232 |
aatcaatgcttgtggaaccgtagatccggataa |
264 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
52770436 |
aatcaatgcttgtggaactgtagatccggataa |
52770404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University