View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7670_high_8 (Length: 250)
Name: NF7670_high_8
Description: NF7670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7670_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 126 - 234
Target Start/End: Complemental strand, 27878592 - 27878484
Alignment:
| Q |
126 |
gtgtgttaaaaaagacaaattcaatacatcgatgtagtgaagagacatttaaacataattgatggagaaagcatgatctttgctacatatatttaactaa |
225 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878592 |
gtgtgttaaaaaagacaaattcaagacattgatgtagtgaagagacatttaaacataattgatggagaaagcatgatctttgctacatatatttaactaa |
27878493 |
T |
|
| Q |
226 |
tataaatag |
234 |
Q |
| |
|
||||||||| |
|
|
| T |
27878492 |
tataaatag |
27878484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 54 - 111
Target Start/End: Complemental strand, 27879502 - 27879445
Alignment:
| Q |
54 |
cttataaggctattttatgacaccgccgaaatgatagagacaatttgagctattaacc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27879502 |
cttataaggctattttatgacaccgccgaaatgatagagacaatttgagctattaacc |
27879445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University