View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7670_low_5 (Length: 277)
Name: NF7670_low_5
Description: NF7670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7670_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 147 - 267
Target Start/End: Original strand, 19962380 - 19962499
Alignment:
| Q |
147 |
tggtttcttgaacccttcttcatcttcctttcctcaacttcctcccctaccccccgtatcaccaccatcatccatggcggcatcaattttggtcgttttg |
246 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
19962380 |
tggtttcttgaacccttcttcatcatcctttcctcaccttcttcccctacccc-cgtatcaccaccatcatccatggcggcaccaactttggtcgttttg |
19962478 |
T |
 |
| Q |
247 |
tctccgctgcaaccgtctctg |
267 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
19962479 |
tctctactgcaaccgtctctg |
19962499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 5e-31; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 195 - 267
Target Start/End: Original strand, 1971415 - 1971487
Alignment:
| Q |
195 |
accccccgtatcaccaccatcatccatggcggcatcaattttggtcgttttgtctccgctgcaaccgtctctg |
267 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1971415 |
accctccgtatcaccaccatcatccatggcggcatcaattttggtcgttttgtctccgctgcaaccgtctctg |
1971487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 37362487 - 37362401
Alignment:
| Q |
30 |
tctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctctttctgtcacattttgattaaaca |
117 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37362487 |
tctccatta-tttgttcaatactgatgcaaactctacagagccccatgcttccctcttcttctccctctgtcacattttgattaaaca |
37362401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 98
Target Start/End: Original strand, 1971280 - 1971365
Alignment:
| Q |
19 |
actatctcacctctccattaatt------tgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctctttct |
98 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
1971280 |
actatctcacctctccattatttatttattgttcaataccaatgcaaactctacagagccccatgcttccctcttcttctccttct |
1971365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 39 - 92
Target Start/End: Original strand, 7841460 - 7841512
Alignment:
| Q |
39 |
atttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttct |
92 |
Q |
| |
|
||||||||||||||| |||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
7841460 |
atttgttcaatacca-tgcaaactctacagaaccccatgcttccctcttcttct |
7841512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 200
Target Start/End: Original strand, 1971360 - 1971400
Alignment:
| Q |
160 |
ccttcttcatcttcctttcctcaacttcctcccctaccccc |
200 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
1971360 |
ccttcttcatcttcctttcctcaccttcttcccctaccccc |
1971400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 21 - 113
Target Start/End: Original strand, 41810356 - 41810445
Alignment:
| Q |
21 |
tatctcacctctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctctttctgtcacattttgatta |
113 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
41810356 |
tatcacacctctccatta--ttgttcaatacccatgcaaactctacagtgccccatgcttccctcttcttctccctctgtcac-ttttgatta |
41810445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 21 - 113
Target Start/End: Complemental strand, 31770959 - 31770870
Alignment:
| Q |
21 |
tatctcacctctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctctttctgtcacattttgatta |
113 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
31770959 |
tatcacacctctccatta--ttgttcaatacccatgcaaactctacagtgccccatgcttccctcttcttctccctctgtcac-ttttgatta |
31770870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 21 - 93
Target Start/End: Complemental strand, 7607971 - 7607901
Alignment:
| Q |
21 |
tatctcacctctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctc |
93 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
7607971 |
tatcacacctctccatta--ttgttcaatacccatgcaaactctacagtgccccatgcttccctcttcttctc |
7607901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 26 - 113
Target Start/End: Original strand, 52130959 - 52131043
Alignment:
| Q |
26 |
cacctctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctctttctgtcacattttgatta |
113 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
52130959 |
cacctctccatta--ttgttcaataccgatgcaaactctacagtgccccatgcttccctcttcttctccctctgtcac-ttttgatta |
52131043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 39 - 92
Target Start/End: Original strand, 53689434 - 53689487
Alignment:
| Q |
39 |
atttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttct |
92 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53689434 |
atttgttcaataccgatgcaaactctacagagccccatgcttccctcttcttct |
53689487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 93
Target Start/End: Complemental strand, 52311539 - 52311477
Alignment:
| Q |
30 |
tctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctc |
93 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
52311539 |
tctccatta-tttgttcaataccgatgcaaactctacagagccccatgttgccctcttcttctc |
52311477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University