View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7670_low_9 (Length: 250)

Name: NF7670_low_9
Description: NF7670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7670_low_9
NF7670_low_9
[»] chr5 (2 HSPs)
chr5 (126-234)||(27878484-27878592)
chr5 (54-111)||(27879445-27879502)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 126 - 234
Target Start/End: Complemental strand, 27878592 - 27878484
Alignment:
126 gtgtgttaaaaaagacaaattcaatacatcgatgtagtgaagagacatttaaacataattgatggagaaagcatgatctttgctacatatatttaactaa 225  Q
    |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27878592 gtgtgttaaaaaagacaaattcaagacattgatgtagtgaagagacatttaaacataattgatggagaaagcatgatctttgctacatatatttaactaa 27878493  T
226 tataaatag 234  Q
    |||||||||    
27878492 tataaatag 27878484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 54 - 111
Target Start/End: Complemental strand, 27879502 - 27879445
Alignment:
54 cttataaggctattttatgacaccgccgaaatgatagagacaatttgagctattaacc 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27879502 cttataaggctattttatgacaccgccgaaatgatagagacaatttgagctattaacc 27879445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University