View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7671_low_29 (Length: 267)
Name: NF7671_low_29
Description: NF7671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7671_low_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 107 - 267
Target Start/End: Complemental strand, 2939711 - 2939550
Alignment:
| Q |
107 |
caccgcttgaatttaaccaagaaaaa-tgacagtagtaacttccttaaattgtgcctcaaattaaaactaacttccatacataactcatttttgaggcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939711 |
caccgcttgaatttaaccaagaaaaaatgacagtagtaacttccttaaattgtgcctcaaattaaaactaacttccatacataactcatttttgaggcat |
2939612 |
T |
 |
| Q |
206 |
cgattattaaatggcaacaaatcacaaaaaacagcagcattagagggactgaattacagaac |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939611 |
cgattattaaatggcaacaaatcacaaaaaacagcagcattagagggactgaattacagaac |
2939550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University