View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7671_low_33 (Length: 250)
Name: NF7671_low_33
Description: NF7671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7671_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 235
Target Start/End: Original strand, 13472925 - 13473146
Alignment:
| Q |
14 |
atagcatatacatgtcgttcattagtgctttgatattgaaattcataactttagcaaagtggcacaaatgcgccctgtcacttagtggacagctacttca |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13472925 |
atagcatatacatgtcattcattagtgctttgatattgaaattcataactttagcaaagtggcacaaattcgccctgtcacttagtggacagctacttca |
13473024 |
T |
|
| Q |
114 |
cttagtttcctccatatatagacaattcataactatatttatgttttcttgtctttttacttttaatgctaattttaaatttgagtcaacttacttctct |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13473025 |
cttagtttcctccatatataggcaattcataactatatttatgttttcttgtctttttacttttaatgccaattttaaatttgagtcaacttacttctct |
13473124 |
T |
|
| Q |
214 |
attgatttataatgtgagttct |
235 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13473125 |
gttgatttataatgtgagttct |
13473146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University