View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7671_low_34 (Length: 247)
Name: NF7671_low_34
Description: NF7671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7671_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 93 - 229
Target Start/End: Original strand, 50529771 - 50529913
Alignment:
| Q |
93 |
atcatatcgtgtttgttgtctgtgactgtgcttaatggtgg------atgttgatcaagaaggatcagttacaaacctgtagcagataaccactgtgatg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529771 |
atcatatcgtgtttgttgtctgtgactgtgcttagtggtggatgtggatgttgatcaagaaggatcagttacaaacctgtagcagataaccactgtgatg |
50529870 |
T |
|
| Q |
187 |
agtaaaacaacaacgacagcaaccaagtcgatttggttaaacc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529871 |
agtaaaacaacaacgacagcaaccaagtcgatttggttaaacc |
50529913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 14 - 63
Target Start/End: Original strand, 50529702 - 50529751
Alignment:
| Q |
14 |
cacacacgtgaacacgaacacattcaatttactcattttctcaaattacc |
63 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50529702 |
cacacacgtgaacacgaacacattcaattaactcattttctcaaattacc |
50529751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University