View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7671_low_36 (Length: 245)
Name: NF7671_low_36
Description: NF7671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7671_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 10 - 168
Target Start/End: Original strand, 50922601 - 50922758
Alignment:
| Q |
10 |
gcagagaagtttggagtttgtaagagcacaaggatttcttaggaagcacatgctataaactttgaagtcagaatgaaatgcggctttacagctttataat |
109 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50922601 |
gcagagaagtttggagtttgtaagagtacaaggatttcttaggaagcacatgctataaactttgaagtcagaatgaaatgcggctttagagctttataat |
50922700 |
T |
|
| Q |
110 |
ttaactatcatttannnnnnnnctttcagaatatcatcctcttttatcatatccctctt |
168 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50922701 |
ttaactatcatttattttttttc-ttcagaatatcatcctcttttatcatatccctctt |
50922758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 20742192 - 20742112
Alignment:
| Q |
10 |
gcagagaagtttggagt--ttgtaagagcacaaggatttcttaggaagcacatgctataaactttgaagtcagaatgaaatg |
89 |
Q |
| |
|
||||||||||||||||| ||| ||| |||||||| |||||||||||||| | ||| | ||||||||||| ||||||||||| |
|
|
| T |
20742192 |
gcagagaagtttggagtatttgcaag-gcacaaggctttcttaggaagcagacgctgtcaactttgaagtgagaatgaaatg |
20742112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University