View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7671_low_37 (Length: 240)

Name: NF7671_low_37
Description: NF7671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7671_low_37
NF7671_low_37
[»] chr8 (1 HSPs)
chr8 (1-224)||(33333058-33333281)


Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 33333281 - 33333058
Alignment:
1 ttgttgccacaaacgtactttaccaacaaagcatgtactattatacatgattatgatt-ctattggatgtccccttttgataaccttaaacatgtgaatc 99  Q
    |||||||||||||||||||||||||||||||||| || ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||    
33333281 ttgttgccacaaacgtactttaccaacaaagcatata-tattatacatgattatgcttgctattggatgtccccttttgataaccttaaacatgtgaatc 33333183  T
100 gttgatttgaacaaattaattattgttactaattaactactagttttgcatttttaaggatgtgattctgatttattgaattttgtagatctgtatgcca 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||    
33333182 gttgatttgaacaaattaattattgttactaattaactactagttttgcatttttaacgatgtgattctaatttattgaattttttagatttgtatgcca 33333083  T
200 attgaggattgctatggtcgttggt 224  Q
    ||||||||||||||||||| |||||    
33333082 attgaggattgctatggtcattggt 33333058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University