View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7671_low_37 (Length: 240)
Name: NF7671_low_37
Description: NF7671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7671_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 33333281 - 33333058
Alignment:
| Q |
1 |
ttgttgccacaaacgtactttaccaacaaagcatgtactattatacatgattatgatt-ctattggatgtccccttttgataaccttaaacatgtgaatc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33333281 |
ttgttgccacaaacgtactttaccaacaaagcatata-tattatacatgattatgcttgctattggatgtccccttttgataaccttaaacatgtgaatc |
33333183 |
T |
 |
| Q |
100 |
gttgatttgaacaaattaattattgttactaattaactactagttttgcatttttaaggatgtgattctgatttattgaattttgtagatctgtatgcca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
33333182 |
gttgatttgaacaaattaattattgttactaattaactactagttttgcatttttaacgatgtgattctaatttattgaattttttagatttgtatgcca |
33333083 |
T |
 |
| Q |
200 |
attgaggattgctatggtcgttggt |
224 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
33333082 |
attgaggattgctatggtcattggt |
33333058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University