View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7673_high_5 (Length: 272)
Name: NF7673_high_5
Description: NF7673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7673_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 3 - 250
Target Start/End: Original strand, 43874922 - 43875174
Alignment:
| Q |
3 |
tagagggcaaaaaaggacaagaaggaactgtagataaagttaaccaaaatttgaaaaacgagtggccgttgaagttcacaagagtaatacaagagccttc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43874922 |
tagagggcaaaaaaggacaagaaggaactgtagataaagttaaccaaaatttgaaaaacaagtggccgttgaagttcacaagagtaatacaagagccttc |
43875021 |
T |
 |
| Q |
103 |
ataacatcattcatttnnnnnnnnnnnnnnnnnnnaac-----tcatcctcatattcaaaatcaaaatttgtctcttctctactcataagaagatattgt |
197 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875022 |
ataacatcattcatttacacaacacaacacaacccaacaaaactcatcctcatattcaaaatcaaaatttgtctcttctctactcataagaagatattgt |
43875121 |
T |
 |
| Q |
198 |
ttgtgtggagaagaagatgagaggaccagtgatggtaagtggtggatgcggtg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875122 |
ttgtgtggagaagaagatgagaggaccagtgatggtaagtggtggatgcggtg |
43875174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University