View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7673_low_11 (Length: 240)
Name: NF7673_low_11
Description: NF7673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7673_low_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 17264720 - 17264497
Alignment:
| Q |
17 |
aggaaggtcttgattttgctttcccgttttgctttctttatcttgttttaagagattaaggacaccttgatttatctacaaagtcatcctcaaatggtga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17264720 |
aggaaggtcttgattttgctttcccgttttgctttctttatcttgttttaagagattaaggacaccttgatttatctacaaagtcatcctcaaatggtga |
17264621 |
T |
 |
| Q |
117 |
ggcttctagggcagctattattcttgctctctgattaattcattgagaaatctacatgtttcagaatctgcaaatattttggattagattttaaccatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17264620 |
ggcttctagggcagctattattcttgctctctgattaattcattgagaaatctacatgtttcagaatctgcaaatattttggattagattttaaccatat |
17264521 |
T |
 |
| Q |
217 |
ggtgatattttttcccgttgcttt |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
17264520 |
ggtgatattttttcccgttgcttt |
17264497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 86
Target Start/End: Original strand, 4300854 - 4300916
Alignment:
| Q |
24 |
tcttgattttgctttcccgttttgctttctttatcttgttttaagagattaaggacaccttga |
86 |
Q |
| |
|
||||| |||| ||| ||| ||||| ||||||| ||||||||||| |||||||||||| ||||| |
|
|
| T |
4300854 |
tcttgctttttcttcccctttttgttttctttgtcttgttttaaaagattaaggacatcttga |
4300916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University