View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7673_low_7 (Length: 250)
Name: NF7673_low_7
Description: NF7673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7673_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 40994308 - 40994247
Alignment:
| Q |
20 |
ctacaagtgctaaacaacattaacaacaagaattagggatgtgtgacatctaacatacataa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40994308 |
ctacaagtgctaaacaacattaacaacaagaattagggatgtgtgacatctaacatacataa |
40994247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University