View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7674_high_6 (Length: 252)
Name: NF7674_high_6
Description: NF7674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7674_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 18911711 - 18911478
Alignment:
| Q |
16 |
atcaaaggatggtcagcatcatttggcatctgtgaacgacattgcatttagtccactgtatgtttcgtcttatcatcattaaattgccatttaaattatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18911711 |
atcaaaggatggtcagcatcatttggcatctgtgaacaacattgcatttagtccactgtatgtttcgtcttatcatcattaaattgccatttaaattatc |
18911612 |
T |
 |
| Q |
116 |
ctaaattataaaaattggaaatttgattcatataatttctattagtatgtctggtgcatttgtcactggtgatgatgaaggttatgctaccatatgggat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18911611 |
ctaaattataaaaattggaaatttgattcatataatttctattagtatgtctggtgcatttgtcactggtgatgatgaaggttatgctaccatatgggat |
18911512 |
T |
 |
| Q |
216 |
gctcgaagtaggaaaagactaattgaggtatttg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18911511 |
gctcgaagtaggaaaagactaattgaggtatttg |
18911478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University