View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7675_high_6 (Length: 248)
Name: NF7675_high_6
Description: NF7675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7675_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 36598249 - 36598013
Alignment:
| Q |
1 |
ctctaggccatctaagtggtcctcttgcattggatctagactggatggtcaggatctttttgcccaggcgattatccaataaaatgttggatgtgtctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36598249 |
ctctaggccatctaagtggtcctcttgcattggatcaagaccggatggtcatgatctttttgcccaggcgattatccaataaaatgttggatgtgtctat |
36598150 |
T |
|
| Q |
101 |
cgtatgatgtcacctgcttccaggtcctaaattggacccgagtccaaaccagatggattttgacccagttcaaaacaattgtaaatttaactattaacgt |
200 |
Q |
| |
|
|||||||||| |||||| |||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| | |
|
|
| T |
36598149 |
tgtatgatgtcgcctgctcccaggttctaaatcggacccgagtccaaaccagatggattttgaccgagttcaaaacaattgtaaatttaattattaacat |
36598050 |
T |
|
| Q |
201 |
tacaaaactagatatttaatgttaaaaaatatatatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36598049 |
tacaaaactagatatttaatgttaaaaaatatatatt |
36598013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University