View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7675_low_11 (Length: 219)
Name: NF7675_low_11
Description: NF7675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7675_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 37024250 - 37024065
Alignment:
| Q |
18 |
aaaggagacggcaaagagggtgataacgttatgtttcggacaccaatgtcccagccagttggagaacgagtcaccttccctccaattgcacggccaagta |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37024250 |
aaaggagatggcaaagagggtgataacgttatgtttcggacaccaatgtcccagccagttggagaacgagtcaccttccctccaattgcacggccaagta |
37024151 |
T |
 |
| Q |
118 |
tctaatcaaattaacattatataaagtaagttaattaatggtaggaaaaacttgcacgtaaaatatattatattaataatagaata |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37024150 |
tctaatcaaattaacattatataaagtaagttaattaatggtaggaaaaacttgcacgtaaaatatattatattaataatagaata |
37024065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 57 - 128
Target Start/End: Original strand, 35902676 - 35902747
Alignment:
| Q |
57 |
acaccaatgtcccagccagttggagaacgagtcaccttccctccaattgcacggccaagtatctaatcaaat |
128 |
Q |
| |
|
|||||||||||||| ||||| ||||| ||| |||||| ||||| | |||||||||||||| || ||||||| |
|
|
| T |
35902676 |
acaccaatgtcccaaccagtaggagagcgacccacctttcctcccaatgcacggccaagtaccttatcaaat |
35902747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University