View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7675_low_5 (Length: 325)
Name: NF7675_low_5
Description: NF7675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7675_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 24 - 192
Target Start/End: Original strand, 43054826 - 43054994
Alignment:
| Q |
24 |
attttcctgagaaaatctttgaaccatgtcgtggcaaacttatgttgatgatcaccttctctgtgacattgaaggtaatcatctcactcatgctgctatc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43054826 |
attttcctgagaaaatctttgaaccatgtcgtggcaaacttatgttgatgatcaccttctctgtgacattgaaggtaatcatctcactcatgctgctatc |
43054925 |
T |
|
| Q |
124 |
ctcggtgtagacggtagcgtttgggctcagagtgctaatttccctcaggtactttcatcaatcgatcga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43054926 |
ctcggtgtagacggtagcgtttgggctcagagtgctaatttccctcaggtactttcatcaatcgatcga |
43054994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 43055070 - 43055122
Alignment:
| Q |
268 |
gagtttcattcttttgtttatcaaatattctagattttccgatctctgctact |
320 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
43055070 |
gagtttcattcttttgtttatcaattattctagattttccgatctctgttact |
43055122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University